Review



paper n a plko  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc paper n a plko
    Paper N A Plko, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1299 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paper+n+a+plko/pLKO%2E1+-+TRC+cloning+vector+(Plasmid+%2310878)/pm41903135-333-62-69
    Average 96 stars, based on 1299 article reviews
    paper n a plko - by Bioz Stars, 2026-10
    96/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Allosterically inhibited PFKL via prostaglandin E2 withholds glucose metabolism and ovarian cancer invasiveness.
    Article Snippet: OVCAR5 Sigma-Aldrich Cat#SCC259 OVK18 Cellosaurus RRID: CVCL_3770 Oligonucleotides See Table S1 Recombinant DNA pCDH-PFKL-WT This paper N/A pCDH-PFKL-K61A This paper N/A pCDH-PFKL-K97A This paper N/A (Continued on next page) Cell Reports 42, 113246, October 31, 2023 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCDH-PFKL-K116A This paper N/A pCDH-PFKL-R201A This paper N/A pCDH-PFKL-K330A This paper N/A pCDH-PFKL-R342A This paper N/A pCDH-PFKL-K365A This paper N/A pCDH-PFKL-K436A This paper N/A pCDH-PFKL-K442AK445A This paper N/A pCDH-PFKL-K447A This paper N/A pCDH-PFKL-R511A This paper N/A pCDH-PFKL-R520A This paper N/A pCDH-PFKL-K524A This paper N/A pCDH-PFKL-K679A This paper N/A pCDH-PFKL-K698A This paper N/A pCDH-PFKL-K727A This paper N/A pCDH-PFKL-K731A This paper N/A pCDH-PFKL-K741A This paper N/A pCDH-PFKL-K763AK764A This paper N/A pCDH-PFKL-K776A This paper N/A pCDH-PFKL-R795AK799A This paper N/A pCDH-PFKL-F720A This paper N/A pCDH-PFKL-D229A This paper N/A pCDH-PFKL-N430A This paper N/A PFKL-HA This paper N/A PFKL-FLAG This paper N/A PTGES3-HA This paper N/A PTGES3-FLAG This paper N/A PFKM-HA This paper N/A PFKP-HA This paper N/A PTGDS-FLAG This paper N/A PTGES3-His This paper N/A LWT009-rPTGES3-WT This paper N/A LWT009-rPTGES3-Y9F This paper N/A LWT009-TET2-CD This paper N/A LWT009-miR200ba This paper N/A PTGES36110-160 This paper N/A PTGES36117-127 This paper N/A PTGES36133-144 This paper N/A PFKL61-78 This paper N/A PFKL679-376 This paper N/A PFKL6377-450 This paper N/A PFKL6451-725 This paper N/A PFKL6726-830 This paper N/A pLKO.1 Moffat et al.57 Addgene plasmid #10878 MP-783 (sgLenti) Boettcher et al.58 Addgene plasmid #105996 PAX2 (psPAX2) A gift from Didier Trono Addgene plasmid #12260 VSVG (pMD2.G) A gift from Didier Trono Addgene plasmid #12259 Software and algorithms Schrodinger version 2015-4 Maestro, Schrödinger https://www.schrodinger.com/ (Continued on next page) 18 Cell Reports 42, 113246, October 31, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Prism8 Graphpad-prism https://www.graphpad.com/features Flowjo BD https://www.flowjo.com/solutions/flowjo/downloads Adobe Illustrator CS2 Adobe https://adobe-illustrator-cs2.de.softonic.com/

    Article Title: MOF-mediated acetylation of SIRT6 disrupts SIRT6-FOXA2 interaction and represses SIRT6 tumor-suppressive function by upregulating ZEB2 in NSCLC.
    Article Snippet: Experimental models: Organisms/strains Mouse: BALB/C-NUDE SLAC Strain# BALB/cASlac-nu Oligonucleotides Human MOF siRNA Santa Cruz Cat#SC-37129 Human MOF shRNA: CGAAAT TGATGCCTGGTATTT This paper N/A Human ZEB2 shRNA: CCCAC CATGAATAGTAATTTA This paper N/A Human HDAC1 sgRNA-1: CACCGCGACATGTTATCT GGACGGA This paper N/A qRT-PCR Primer: Human ZEB2 Forward: AACCATGAGTCCTCCCCACA This paper N/A qRT-PCR Primer: Human ZEB2 Reverse: GTCTTCCTTCATTTCTTCTGGACC This paper N/A qRT-PCR Primer: Human Actin Forward: ACAGAGCCTCGCCTTTGC This paper N/A qRT-PCR Primer: Human Actin Reverse: ATCATCCATGGTGAGCTGGC This paper N/A ChIP-qRT-PCR Primer: Human ZEB2 Promoter Region 1 Forward: GAAGGGAGGGAGGTGGAATTT This paper N/A ChIP-qRT-PCR Primer: Human ZEB2 Promoter Region 1 Reverse: CGCCAAGTTTCTCTCTGGGAA This paper N/A ChIP-qRT-PCR Primer: Human ZEB2 Promoter Region 2 Forward: ACTATCTGGATTGAGGACCCG This paper N/A ChIP-qRT-PCR Primer: Human ZEB2 Promoter Region 2 Reverse: TGGCATCATTATCCTCATCACT This paper N/A Recombinant DNA FLAG-SIRT6 North et al.51 Addgene plasmid # 13817 (Continued on next page) 18 Cell Reports 42, 112939, August 29, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER FLAG-SIRT6 H133Y Tennen et al.9 N/A FLAG-SIRT6 domain deletion mutants (DC, DN, core, CTE, NTE) Tennen et al.9 N/A FLAG-SIRT6 mutation (K17R, K128R, K160R, K170R, K245R, K267R, K300R, K128/160R, K128/267R, K160/267R, K3R, K3Q) This paper N/A Myc-MOF This paper N/A Myc-MOF K274R This paper N/A FLAG-HATs (MOF, Tip60, GCN5) This paper N/A HA-p300 This paper N/A His-HDAC1 This paper N/A FLAG-HDACs (HDAC1-5) This paper N/A FLAG-HDAC1 H141A This paper N/A HA-SIRT1 This paper N/A HA-SIRT1 H363Y This paper N/A GST-MOF This paper N/A pET–28a (+) Novagen Cat#69864 His-SIRT6 This paper N/A His-HDAC1 This paper N/A His-HDAC2 This paper N/A pLenti-CMV-GFP-Neo Campeau et al.52 Addgene plasmid #17447 pLenti-CMV-GFP-Zeo Campeau et al.52 Addgene plasmid #17449 pLenti-CMV-SIRT6-Neo This paper N/A pLenti-CMV-MOF-Zeo This paper N/A pLenti-CMV-ZEB2-Zeo This paper N/A PX459 Ran et al.53 Addgene plasmid #62988 PX459-HDAC1-KO This paper N/A pLKO.1 Stewart et al.54 Addgene plasmid #8453 pLKO.1-shMOF This paper N/A pLKO.1-shZEB2 This paper N/A Software and algorithms GraphPad Prism GraphPad https://www.graphpad.com Other None None None ..

    Article Title: STUB1-VCP/p97 complex regulates mitophagy via fine-tuning of PINK1 levels.
    Article Snippet: .. UUUGAUCUGAGCUAGCUGCUU Designed in the following website: http://biodev.extra.cea.fr/DSIR/DSIR.html N/A VCP#3 GCAAGAAGAUGGAUCUCAUUG AUGAGAUCCAUCUUCUUGCGG Designed in the following website: http://biodev.extra.cea.fr/DSIR/DSIR.html N/A Recombinant DNA pLenti-puro Addgene 39481 pLenti-Puro PINK1-Myc This paper N/A pLenti-Puro FLAG-VCP This paper N/A pLenti-Puro Halo-EV This paper N/A pLenti-Puro Halo-STUB1-WT This paper N/A pLenti-Puro Halo-STUB1-ΔTRP This paper N/A lentiCRISPR v2 Addgene 52961 lentiCRISPR v2 sgSTUB1#1 This paper N/A lentiCRISPR v2 sgSTUB1#2 This paper N/A pLKO.1 - TRC cloning vector Addgene 10878 pPLKO.1-shVCP#1 This paper N/A pPLKO.1-shVCP#2 This paper N/A pRK5-HA-Ubiquitin-WT Addgene 17608 pRK5-HA-Ubiquitin-K48 Addgene 17605 pCDNA4-PINK1-WT-3XFLAG This paper N/A pCMVTNT PINK1 N-myc Addgene 13313 pCMVTNT PINK1 C-myc Addgene 13314 pCMVTNT PINK1 C-myc P95A This paper N/A pCMVTNT PINK1 C-myc F104A This paper N/A VCP-EGFP Addgene 23971 pCDNA5-VCP-HA This paper N/A pCDNA4-VCP-WT-3XFLAG This paper N/A pCMV-Tag2B FLAG-VCP Described previously 41 N/A pCMV-Tag2B FLAG-VCP-ΔN Described previously 41 N/A pCMV-Tag2B FLAG-VCP-ΔD1 Described previously 41 N/A pCMV-Tag2B FLAG-VCP-ΔN-D1 Described previously 41 N/A pCMV-Tag2B FLAG-VCP-ΔD2 Described previously 41 N/A pCMV-Tag2B FLAG-VCP-R191Q This paper N/A pCMV-Tag2B FLAG-VCP-R155H This paper N/A pCMV-Tag2B FLAG-VCP-R232E This paper N/A pmCherry-STUB1-WT This paper N/A pmCherry-STUB1-ΔTRP This paper N/A pmCherry-STUB1-ΔCC This paper N/A pmCherry-STUB1-ΔU-Box This paper N/A pMTS-mCherry-STUB1-WT This paper N/A pMTS-mCherry-STUB1-ΔTRP This paper N/A pmCherry-SIWWPD This paper N/A pmCherry-SIWWHR This paper N/A pCDNA4-STUB1-WT-3XFLAG This paper N/A pCDNA4-STUB1-ΔTRP-3XFLAG This paper N/A pCDNA4-STUB1-ΔCC-3XFLAG This paper N/A pCDNA4-STUB1-ΔU-Box-3XFLAG This paper N/A pCDNA4-STUB1-E28K-3XFLAG This paper N/A (Continued on next page) Cell Reports 45, 117183, April 28, 2026 23 ..

    Software:

    Article Title: Allosterically inhibited PFKL via prostaglandin E2 withholds glucose metabolism and ovarian cancer invasiveness.
    Article Snippet: OVCAR5 Sigma-Aldrich Cat#SCC259 OVK18 Cellosaurus RRID: CVCL_3770 Oligonucleotides See Table S1 Recombinant DNA pCDH-PFKL-WT This paper N/A pCDH-PFKL-K61A This paper N/A pCDH-PFKL-K97A This paper N/A (Continued on next page) Cell Reports 42, 113246, October 31, 2023 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCDH-PFKL-K116A This paper N/A pCDH-PFKL-R201A This paper N/A pCDH-PFKL-K330A This paper N/A pCDH-PFKL-R342A This paper N/A pCDH-PFKL-K365A This paper N/A pCDH-PFKL-K436A This paper N/A pCDH-PFKL-K442AK445A This paper N/A pCDH-PFKL-K447A This paper N/A pCDH-PFKL-R511A This paper N/A pCDH-PFKL-R520A This paper N/A pCDH-PFKL-K524A This paper N/A pCDH-PFKL-K679A This paper N/A pCDH-PFKL-K698A This paper N/A pCDH-PFKL-K727A This paper N/A pCDH-PFKL-K731A This paper N/A pCDH-PFKL-K741A This paper N/A pCDH-PFKL-K763AK764A This paper N/A pCDH-PFKL-K776A This paper N/A pCDH-PFKL-R795AK799A This paper N/A pCDH-PFKL-F720A This paper N/A pCDH-PFKL-D229A This paper N/A pCDH-PFKL-N430A This paper N/A PFKL-HA This paper N/A PFKL-FLAG This paper N/A PTGES3-HA This paper N/A PTGES3-FLAG This paper N/A PFKM-HA This paper N/A PFKP-HA This paper N/A PTGDS-FLAG This paper N/A PTGES3-His This paper N/A LWT009-rPTGES3-WT This paper N/A LWT009-rPTGES3-Y9F This paper N/A LWT009-TET2-CD This paper N/A LWT009-miR200ba This paper N/A PTGES36110-160 This paper N/A PTGES36117-127 This paper N/A PTGES36133-144 This paper N/A PFKL61-78 This paper N/A PFKL679-376 This paper N/A PFKL6377-450 This paper N/A PFKL6451-725 This paper N/A PFKL6726-830 This paper N/A pLKO.1 Moffat et al.57 Addgene plasmid #10878 MP-783 (sgLenti) Boettcher et al.58 Addgene plasmid #105996 PAX2 (psPAX2) A gift from Didier Trono Addgene plasmid #12260 VSVG (pMD2.G) A gift from Didier Trono Addgene plasmid #12259 Software and algorithms Schrodinger version 2015-4 Maestro, Schrödinger https://www.schrodinger.com/ (Continued on next page) 18 Cell Reports 42, 113246, October 31, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Prism8 Graphpad-prism https://www.graphpad.com/features Flowjo BD https://www.flowjo.com/solutions/flowjo/downloads Adobe Illustrator CS2 Adobe https://adobe-illustrator-cs2.de.softonic.com/

    Article Title: MOF-mediated acetylation of SIRT6 disrupts SIRT6-FOXA2 interaction and represses SIRT6 tumor-suppressive function by upregulating ZEB2 in NSCLC.
    Article Snippet: Experimental models: Organisms/strains Mouse: BALB/C-NUDE SLAC Strain# BALB/cASlac-nu Oligonucleotides Human MOF siRNA Santa Cruz Cat#SC-37129 Human MOF shRNA: CGAAAT TGATGCCTGGTATTT This paper N/A Human ZEB2 shRNA: CCCAC CATGAATAGTAATTTA This paper N/A Human HDAC1 sgRNA-1: CACCGCGACATGTTATCT GGACGGA This paper N/A qRT-PCR Primer: Human ZEB2 Forward: AACCATGAGTCCTCCCCACA This paper N/A qRT-PCR Primer: Human ZEB2 Reverse: GTCTTCCTTCATTTCTTCTGGACC This paper N/A qRT-PCR Primer: Human Actin Forward: ACAGAGCCTCGCCTTTGC This paper N/A qRT-PCR Primer: Human Actin Reverse: ATCATCCATGGTGAGCTGGC This paper N/A ChIP-qRT-PCR Primer: Human ZEB2 Promoter Region 1 Forward: GAAGGGAGGGAGGTGGAATTT This paper N/A ChIP-qRT-PCR Primer: Human ZEB2 Promoter Region 1 Reverse: CGCCAAGTTTCTCTCTGGGAA This paper N/A ChIP-qRT-PCR Primer: Human ZEB2 Promoter Region 2 Forward: ACTATCTGGATTGAGGACCCG This paper N/A ChIP-qRT-PCR Primer: Human ZEB2 Promoter Region 2 Reverse: TGGCATCATTATCCTCATCACT This paper N/A Recombinant DNA FLAG-SIRT6 North et al.51 Addgene plasmid # 13817 (Continued on next page) 18 Cell Reports 42, 112939, August 29, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER FLAG-SIRT6 H133Y Tennen et al.9 N/A FLAG-SIRT6 domain deletion mutants (DC, DN, core, CTE, NTE) Tennen et al.9 N/A FLAG-SIRT6 mutation (K17R, K128R, K160R, K170R, K245R, K267R, K300R, K128/160R, K128/267R, K160/267R, K3R, K3Q) This paper N/A Myc-MOF This paper N/A Myc-MOF K274R This paper N/A FLAG-HATs (MOF, Tip60, GCN5) This paper N/A HA-p300 This paper N/A His-HDAC1 This paper N/A FLAG-HDACs (HDAC1-5) This paper N/A FLAG-HDAC1 H141A This paper N/A HA-SIRT1 This paper N/A HA-SIRT1 H363Y This paper N/A GST-MOF This paper N/A pET–28a (+) Novagen Cat#69864 His-SIRT6 This paper N/A His-HDAC1 This paper N/A His-HDAC2 This paper N/A pLenti-CMV-GFP-Neo Campeau et al.52 Addgene plasmid #17447 pLenti-CMV-GFP-Zeo Campeau et al.52 Addgene plasmid #17449 pLenti-CMV-SIRT6-Neo This paper N/A pLenti-CMV-MOF-Zeo This paper N/A pLenti-CMV-ZEB2-Zeo This paper N/A PX459 Ran et al.53 Addgene plasmid #62988 PX459-HDAC1-KO This paper N/A pLKO.1 Stewart et al.54 Addgene plasmid #8453 pLKO.1-shMOF This paper N/A pLKO.1-shZEB2 This paper N/A Software and algorithms GraphPad Prism GraphPad https://www.graphpad.com Other None None None ..

    Mutagenesis:

    Article Title: MOF-mediated acetylation of SIRT6 disrupts SIRT6-FOXA2 interaction and represses SIRT6 tumor-suppressive function by upregulating ZEB2 in NSCLC.
    Article Snippet: Experimental models: Organisms/strains Mouse: BALB/C-NUDE SLAC Strain# BALB/cASlac-nu Oligonucleotides Human MOF siRNA Santa Cruz Cat#SC-37129 Human MOF shRNA: CGAAAT TGATGCCTGGTATTT This paper N/A Human ZEB2 shRNA: CCCAC CATGAATAGTAATTTA This paper N/A Human HDAC1 sgRNA-1: CACCGCGACATGTTATCT GGACGGA This paper N/A qRT-PCR Primer: Human ZEB2 Forward: AACCATGAGTCCTCCCCACA This paper N/A qRT-PCR Primer: Human ZEB2 Reverse: GTCTTCCTTCATTTCTTCTGGACC This paper N/A qRT-PCR Primer: Human Actin Forward: ACAGAGCCTCGCCTTTGC This paper N/A qRT-PCR Primer: Human Actin Reverse: ATCATCCATGGTGAGCTGGC This paper N/A ChIP-qRT-PCR Primer: Human ZEB2 Promoter Region 1 Forward: GAAGGGAGGGAGGTGGAATTT This paper N/A ChIP-qRT-PCR Primer: Human ZEB2 Promoter Region 1 Reverse: CGCCAAGTTTCTCTCTGGGAA This paper N/A ChIP-qRT-PCR Primer: Human ZEB2 Promoter Region 2 Forward: ACTATCTGGATTGAGGACCCG This paper N/A ChIP-qRT-PCR Primer: Human ZEB2 Promoter Region 2 Reverse: TGGCATCATTATCCTCATCACT This paper N/A Recombinant DNA FLAG-SIRT6 North et al.51 Addgene plasmid # 13817 (Continued on next page) 18 Cell Reports 42, 112939, August 29, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER FLAG-SIRT6 H133Y Tennen et al.9 N/A FLAG-SIRT6 domain deletion mutants (DC, DN, core, CTE, NTE) Tennen et al.9 N/A FLAG-SIRT6 mutation (K17R, K128R, K160R, K170R, K245R, K267R, K300R, K128/160R, K128/267R, K160/267R, K3R, K3Q) This paper N/A Myc-MOF This paper N/A Myc-MOF K274R This paper N/A FLAG-HATs (MOF, Tip60, GCN5) This paper N/A HA-p300 This paper N/A His-HDAC1 This paper N/A FLAG-HDACs (HDAC1-5) This paper N/A FLAG-HDAC1 H141A This paper N/A HA-SIRT1 This paper N/A HA-SIRT1 H363Y This paper N/A GST-MOF This paper N/A pET–28a (+) Novagen Cat#69864 His-SIRT6 This paper N/A His-HDAC1 This paper N/A His-HDAC2 This paper N/A pLenti-CMV-GFP-Neo Campeau et al.52 Addgene plasmid #17447 pLenti-CMV-GFP-Zeo Campeau et al.52 Addgene plasmid #17449 pLenti-CMV-SIRT6-Neo This paper N/A pLenti-CMV-MOF-Zeo This paper N/A pLenti-CMV-ZEB2-Zeo This paper N/A PX459 Ran et al.53 Addgene plasmid #62988 PX459-HDAC1-KO This paper N/A pLKO.1 Stewart et al.54 Addgene plasmid #8453 pLKO.1-shMOF This paper N/A pLKO.1-shZEB2 This paper N/A Software and algorithms GraphPad Prism GraphPad https://www.graphpad.com Other None None None ..

    Recombinant:

    Article Title: STUB1-VCP/p97 complex regulates mitophagy via fine-tuning of PINK1 levels.
    Article Snippet: .. UUUGAUCUGAGCUAGCUGCUU Designed in the following website: http://biodev.extra.cea.fr/DSIR/DSIR.html N/A VCP#3 GCAAGAAGAUGGAUCUCAUUG AUGAGAUCCAUCUUCUUGCGG Designed in the following website: http://biodev.extra.cea.fr/DSIR/DSIR.html N/A Recombinant DNA pLenti-puro Addgene 39481 pLenti-Puro PINK1-Myc This paper N/A pLenti-Puro FLAG-VCP This paper N/A pLenti-Puro Halo-EV This paper N/A pLenti-Puro Halo-STUB1-WT This paper N/A pLenti-Puro Halo-STUB1-ΔTRP This paper N/A lentiCRISPR v2 Addgene 52961 lentiCRISPR v2 sgSTUB1#1 This paper N/A lentiCRISPR v2 sgSTUB1#2 This paper N/A pLKO.1 - TRC cloning vector Addgene 10878 pPLKO.1-shVCP#1 This paper N/A pPLKO.1-shVCP#2 This paper N/A pRK5-HA-Ubiquitin-WT Addgene 17608 pRK5-HA-Ubiquitin-K48 Addgene 17605 pCDNA4-PINK1-WT-3XFLAG This paper N/A pCMVTNT PINK1 N-myc Addgene 13313 pCMVTNT PINK1 C-myc Addgene 13314 pCMVTNT PINK1 C-myc P95A This paper N/A pCMVTNT PINK1 C-myc F104A This paper N/A VCP-EGFP Addgene 23971 pCDNA5-VCP-HA This paper N/A pCDNA4-VCP-WT-3XFLAG This paper N/A pCMV-Tag2B FLAG-VCP Described previously 41 N/A pCMV-Tag2B FLAG-VCP-ΔN Described previously 41 N/A pCMV-Tag2B FLAG-VCP-ΔD1 Described previously 41 N/A pCMV-Tag2B FLAG-VCP-ΔN-D1 Described previously 41 N/A pCMV-Tag2B FLAG-VCP-ΔD2 Described previously 41 N/A pCMV-Tag2B FLAG-VCP-R191Q This paper N/A pCMV-Tag2B FLAG-VCP-R155H This paper N/A pCMV-Tag2B FLAG-VCP-R232E This paper N/A pmCherry-STUB1-WT This paper N/A pmCherry-STUB1-ΔTRP This paper N/A pmCherry-STUB1-ΔCC This paper N/A pmCherry-STUB1-ΔU-Box This paper N/A pMTS-mCherry-STUB1-WT This paper N/A pMTS-mCherry-STUB1-ΔTRP This paper N/A pmCherry-SIWWPD This paper N/A pmCherry-SIWWHR This paper N/A pCDNA4-STUB1-WT-3XFLAG This paper N/A pCDNA4-STUB1-ΔTRP-3XFLAG This paper N/A pCDNA4-STUB1-ΔCC-3XFLAG This paper N/A pCDNA4-STUB1-ΔU-Box-3XFLAG This paper N/A pCDNA4-STUB1-E28K-3XFLAG This paper N/A (Continued on next page) Cell Reports 45, 117183, April 28, 2026 23 ..

    Cloning:

    Article Title: STUB1-VCP/p97 complex regulates mitophagy via fine-tuning of PINK1 levels.
    Article Snippet: .. UUUGAUCUGAGCUAGCUGCUU Designed in the following website: http://biodev.extra.cea.fr/DSIR/DSIR.html N/A VCP#3 GCAAGAAGAUGGAUCUCAUUG AUGAGAUCCAUCUUCUUGCGG Designed in the following website: http://biodev.extra.cea.fr/DSIR/DSIR.html N/A Recombinant DNA pLenti-puro Addgene 39481 pLenti-Puro PINK1-Myc This paper N/A pLenti-Puro FLAG-VCP This paper N/A pLenti-Puro Halo-EV This paper N/A pLenti-Puro Halo-STUB1-WT This paper N/A pLenti-Puro Halo-STUB1-ΔTRP This paper N/A lentiCRISPR v2 Addgene 52961 lentiCRISPR v2 sgSTUB1#1 This paper N/A lentiCRISPR v2 sgSTUB1#2 This paper N/A pLKO.1 - TRC cloning vector Addgene 10878 pPLKO.1-shVCP#1 This paper N/A pPLKO.1-shVCP#2 This paper N/A pRK5-HA-Ubiquitin-WT Addgene 17608 pRK5-HA-Ubiquitin-K48 Addgene 17605 pCDNA4-PINK1-WT-3XFLAG This paper N/A pCMVTNT PINK1 N-myc Addgene 13313 pCMVTNT PINK1 C-myc Addgene 13314 pCMVTNT PINK1 C-myc P95A This paper N/A pCMVTNT PINK1 C-myc F104A This paper N/A VCP-EGFP Addgene 23971 pCDNA5-VCP-HA This paper N/A pCDNA4-VCP-WT-3XFLAG This paper N/A pCMV-Tag2B FLAG-VCP Described previously 41 N/A pCMV-Tag2B FLAG-VCP-ΔN Described previously 41 N/A pCMV-Tag2B FLAG-VCP-ΔD1 Described previously 41 N/A pCMV-Tag2B FLAG-VCP-ΔN-D1 Described previously 41 N/A pCMV-Tag2B FLAG-VCP-ΔD2 Described previously 41 N/A pCMV-Tag2B FLAG-VCP-R191Q This paper N/A pCMV-Tag2B FLAG-VCP-R155H This paper N/A pCMV-Tag2B FLAG-VCP-R232E This paper N/A pmCherry-STUB1-WT This paper N/A pmCherry-STUB1-ΔTRP This paper N/A pmCherry-STUB1-ΔCC This paper N/A pmCherry-STUB1-ΔU-Box This paper N/A pMTS-mCherry-STUB1-WT This paper N/A pMTS-mCherry-STUB1-ΔTRP This paper N/A pmCherry-SIWWPD This paper N/A pmCherry-SIWWHR This paper N/A pCDNA4-STUB1-WT-3XFLAG This paper N/A pCDNA4-STUB1-ΔTRP-3XFLAG This paper N/A pCDNA4-STUB1-ΔCC-3XFLAG This paper N/A pCDNA4-STUB1-ΔU-Box-3XFLAG This paper N/A pCDNA4-STUB1-E28K-3XFLAG This paper N/A (Continued on next page) Cell Reports 45, 117183, April 28, 2026 23 ..

    other:

    Article Title: PYHIN protein IFI207 regulates cytokine transcription and IRF7 and contributes to the establishment of K. pneumoniae infection.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pcDNA3-Flag-TBK Previously described Fitzgerald et al.50 N/A pCMV-HA Clontech Cat#631604 pCMV-HA-Ifi207 This paper N/A pCMV-HA-Ifi207DHIN This paper N/A pCMV-HA-Ifi207DPyr This paper N/A pCMV-HA-Ifi207DPyrHIN This paper N/A pCMV-HA-Pyr207 This paper N/A pCR4-TOPO-Ifi207 ImaGenes IRCKp5014A0215Q pMSCV-PIG-IFI205-HA Previously described Ghosh et al.14 N/A pFlag-IRF3-5D Gift from Prof. John Hiscott, Pasteur Laboratories, Rome, Italy Lin et al.51 N/A pFlag-IRF7 Gift from Prof. John Hiscott, Pasteur Laboratories, Rome, Italy Lin et al.52 N/A pFlag-IRF7-4D Gift from Prof. John Hiscott, Pasteur Laboratories, Rome, Italy Lin et al.52 N/A MyD88-Myc Previously described Brady et al.53 N/A pGL3–5xNFkB Gift from Dr Robert Hofmeister, Universität Regensburg, Germany Radons et al.54 N/A pGL3-Asc-luc ( 2000) Previously described Gosh et al.14 N/A pGL3-hTNF(-1173) Gift from Prof. Irina Udalova, University of Oxford, UK kuprash et al.55 N/A pGL3-mTnf(-1260) Gift from Dr D Kuprash, EIMB, Moscow, Russia kuprash et al.55 N/A phRL-TK reporter Promega Cat#E6241 pIL6-luc651 Gift from Prof. Mark Wewers, The Ohio State University, Columbus, USA Seshadri et al.56 N/A pISRE-luc Agilent Cat#219089 pLKO.1- Ctrl shRNA lentiviral vector, target sequence:CAACAAGATGAAG AGCACCAA This paper N/A pLKO.1 puro lentiviral vector Addgene Stewart et al.57 Addgene#8453 pLKO.1-Ifi204shRNA lentiviral vector, target sequence: ACCTGAATGCCA ATGATATTT This paper N/A pLKO.1-Ifi207shRNA lentiviral vector, target sequence: GGGCTTTCTTATA TGCTTTAC This paper N/A pLKO.1-Ifi207shRNA#2 lentiviral vector, target sequence: AACTCTATCAACAA CATCTAG This paper N/A pMD2.G lentiviral envelope vector Addgene (Trono D., unpublished) Addgene#12259 psPAX2 lentiviral packaging vector Addgene (Trono D., unpublished) Addgene#12260 Software and algorithms Ensmbl genome browser Ensmbl https://www.ensembl.org/index.html GraphPad Prism 9 GraphPad ver.



    Similar Products

    96
    Addgene inc paper n a plko
    Paper N A Plko, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paper+n+a+plko/pLKO%2E1+-+TRC+cloning+vector+(Plasmid+%2310878)/pm41903135-333-62-69
    Average 96 stars, based on 1 article reviews
    paper n a plko - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    98
    Addgene inc paper n a plko 1 blast addgene
    Paper N A Plko 1 Blast Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paper+n+a+plko/pMD2%2EG+(Plasmid+%2312259)/pm41844151-257-71-74
    Average 98 stars, based on 1 article reviews
    paper n a plko 1 blast addgene - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    94
    Addgene inc paper n a plko 1 hygro addgene
    Paper N A Plko 1 Hygro Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paper+n+a+plko/pLKO%2E1+hygro+(Plasmid+%2324150)/pm41742405-307-173-177
    Average 94 stars, based on 1 article reviews
    paper n a plko 1 hygro addgene - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    96
    Addgene inc paper n a recombinant dna tet plko puro d wiederschain addgene plasmid
    Paper N A Recombinant Dna Tet Plko Puro D Wiederschain Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paper+n+a+plko/Tet-pLKO-puro+(Plasmid+%2321915)/pm41579862-800-142-149
    Average 96 stars, based on 1 article reviews
    paper n a recombinant dna tet plko puro d wiederschain addgene plasmid - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    93
    Addgene inc paper n a plko 1 shnt addgene
    Paper N A Plko 1 Shnt Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paper+n+a+plko/pLKO%2E1-puro-shNT+(Plasmid+%23109012)/pm41076632-47-166-169
    Average 93 stars, based on 1 article reviews
    paper n a plko 1 shnt addgene - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    Addgene inc paper n a plko shegfr c egfp
    Paper N A Plko Shegfr C Egfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paper+n+a+plko/pLKO%2E3G+(Plasmid+%2314748)/pm41027427-222-108-105
    Average 93 stars, based on 1 article reviews
    paper n a plko shegfr c egfp - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    Addgene inc paper n a plko 3
    Paper N A Plko 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paper+n+a+plko/pLKO%2E3G+(Plasmid+%2314748)/pm41027427-222-94-105
    Average 93 stars, based on 1 article reviews
    paper n a plko 3 - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    96
    Addgene inc paper n a plko 1 puro addgene
    Paper N A Plko 1 Puro Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paper+n+a+plko/pLKO%2E1+-+TRC+cloning+vector+(Plasmid+%2310878)/pm41004338-316-278-282
    Average 96 stars, based on 1 article reviews
    paper n a plko 1 puro addgene - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    98
    Addgene inc paper n a recombinant dna pspax2 addgene rrid addgene 12260 pmd2 g addgene rrid addgene 12259 plko 1 puro sh c19orf12
    Paper N A Recombinant Dna Pspax2 Addgene Rrid Addgene 12260 Pmd2 G Addgene Rrid Addgene 12259 Plko 1 Puro Sh C19orf12, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paper+n+a+plko/pMD2%2EG+(Plasmid+%2312259)/pm40833854-629-161-166
    Average 98 stars, based on 1 article reviews
    paper n a recombinant dna pspax2 addgene rrid addgene 12260 pmd2 g addgene rrid addgene 12259 plko 1 puro sh c19orf12 - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    96
    Addgene inc paper n a recombinant dna plko 1 puro addgene
    Paper N A Recombinant Dna Plko 1 Puro Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paper+n+a+plko/pLKO%2E1+puro+(Plasmid+%238453)/pm40460833-585-138-144
    Average 96 stars, based on 1 article reviews
    paper n a recombinant dna plko 1 puro addgene - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    Image Search Results